gapB [2019-08-08 12:55:20]

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH

locus: BSU_29020

pI: 6.45

mw: 37.32 kDa

protein length: 340 aa

gene length: 1023 bp

function: anabolic enzyme in gluconeogenesis

product: glyceraldehyde-3-phosphate dehydrogenase 2

essential: no

ec: 1.2.1.59

synonyms

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]

Gene

Coordinates: 2,967,032 → 2,968,054

Phenotypes of a mutant

• inactivation of ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells [Pubmed|26735940]

The protein

Catalyzed reaction/ biological activity

• D-glyceraldehyde 3-phosphate + phosphate + NAD(P)⁺ = 3-phospho-D-glyceroyl phosphate + NAD(P)H (according to Swiss-Prot)
• This reaction is part of the gluconeogenesis

Protein family

• glyceraldehyde-3-phosphate dehydrogenase family (with [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA], according to UniProt)

Paralogous protein(s)

• [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA]

Kinetic information

• Michaelis-Menten [Pubmed|10799476]

[SW|Domains]

• Nucleotid bindinge domain (12-13)
• 2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)

[SW|Cofactors]

• NADP⁺ (preferentially) and NAD⁺ [Pubmed|10799476]

Structure

• [PDB|3PRL] (from ''B. halodurans'')

[SW|Localization]

• Cytoplasm (Homogeneous) [Pubmed|16479537]

additional information

• degraded after a shift from malate to glucose with an estimated half-life time of approx. 3 hours by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|28760849]

Expression and Regulation

Operons

• genes: [gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
  description: [Pubmed|15720552]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]

  regulation

  • ''[protein|search|gapB]'': repressed in the presence of glucose ([protein|search|CcpN]) [Pubmed|15720552]

  additional information

  • '[protein|search|speD]': the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) [PubMed|21815947]

Biological materials

Mutant

• MGNA-A121 (gapB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/121 NBRP B. subtilis, Japan]
• GP701 (''gapB''::''spec''), available in [SW|Stülke] lab
• 1A1004 ( ''gapB''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1004&Search=1A1004 BGSC]
• BKE29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC
• BKK29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC

labs

• [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

• 16479537,10799476,10844697,15720552,18586936,17114254,22190493,23033921,22740702,26735940,28760849